tRNA Information : BBR47_t0250

Display	1000bp 10000bp 100000bp Clone

Brevibacillus brevis NBRC 100599 chromosome	Legend Jump
Overview  Genome Clone

Center position		change
ID		change
Gene name		change

Organism	Brevibacillus brevis NBRC 100599
Replicon	chromosome
Start / Stop / Direction	57,507 / 57,595 / +
Location	57507..57595
Type	tRNA : tRNA-Ser
Length	89 bp

Product	tRNA-Ser

>BBR47_t0250 tRNA-Ser
GGAGAGATACCCAAGTGGTCATAAGGGGACGCACTCGAAATGCGTTAGGCGTCGTGAGGC
GTGCGTGGGTTCGAATCCCACTCTCTCCG

NBRC No.	clone name	start	stop	length(bp)
G10-001-002	BB1FE1L10023G09	26,882	59,887	33,006
G10-001-003	BB1FE1L10009G06	40,439	77,360	36,922

We have been distributing copies of the microbial genomic DNA clones constructed during the course of each of the genomic DNA sequencing projects.
You can find more detailed information at http://www.nbrc.nite.go.jp/e/mdna-e.html.