tRNA Information : BBR47_t0470

Display	1000bp 10000bp 100000bp Clone

Brevibacillus brevis NBRC 100599 chromosome	Legend Jump
Overview  Genome Clone

Center position		change
ID		change
Gene name		change

Organism	Brevibacillus brevis NBRC 100599
Replicon	chromosome
Start / Stop / Direction	266,206 / 266,282 / +
Location	266206..266282
Type	tRNA : tRNA-Arg
Length	77 bp

Product	tRNA-Arg

>BBR47_t0470 tRNA-Arg
GTGCCCTTAGCTCAGCTGGATAGAGCGTTTGACTACGAATCAAAAGGTCGGGAGTTCGAA
TCTCTCAGGGCACGCCA

NBRC No.	clone name	start	stop	length(bp)
G10-001-009	BB1FE1L10029E04	265,703	304,114	38,412

We have been distributing copies of the microbial genomic DNA clones constructed during the course of each of the genomic DNA sequencing projects.
You can find more detailed information at http://www.nbrc.nite.go.jp/e/mdna-e.html.