CDS Information : MCP_0010

Display	1000bp 10000bp 100000bp Clone

Methanocella paludicola SANAET (= NBRC 101707T) chromosome	Legend Jump
Overview  Genome Clone

Center position		change
ID		change
Gene name		change

Organism	Methanocella paludicola SANAET (= NBRC 101707T)
Replicon	chromosome
Start / Stop / Direction	8,951 / 8,775 / -
Location	complement(8775..8951)
Type	CDS
Length	177 bp (58 aa)

Product	50S ribosomal protein LX
Gene name	rplX
Functional category	Information Pathways - Translation
EC number
Note
KEGG pathway	map:03010 KO:K02944
Sequence feature
References	HAMAP:MF_00273

BLASTP Database:UniProtKB:15.0 show BLAST table	1 E=5e-14 Q46FA0_METBF LSU ribosomal protein LX Alignment 2 E=2e-13 Q12ZJ6_METBU LSU ribosomal protein LX Alignment 3 E=2e-12 Q0W5H3_UNCMA 50S ribosomal protein LX Alignment 4 E=4e-12 RLX_METMA 50S ribosomal protein LX Alignment 5 E=5e-12 RLX_METAC 50S ribosomal protein LX Alignment
HAMAP Database:HAMAP:20061004	MF_00273   RLX
InterPro Database:interpro:18.0	IPR002768 Ribosomal LX protein (Family) PD010302   RLX_METMA_Q8PYQ2; PF01911   Ribosomal_LX
SignalP	No significant hit
TMHMM	No significant hit
SOSUI	No significant hit

size of protein	58 amino acids
molecular mass	6,599.40 Da
pI	9.14
aa composition	Ala Val Leu Ile Phe Trp Pro Met Gly Ser 6.9 (4aa) 10.3 (6aa) 1.7 (1aa) 6.9 (4aa) 5.2 (3aa) 1.7 (1aa) 0 (0aa) 1.7 (1aa) 6.9 (4aa) 8.6 (5aa) Thr Cys Asn Gln Tyr Lys His Arg Asp Glu 3.4 (2aa) 0 (0aa) 10.3 (6aa) 3.4 (2aa) 1.7 (1aa) 10.3 (6aa) 1.7 (1aa) 5.2 (3aa) 0 (0aa) 13.8 (8aa)

>MCP_0010 50S ribosomal protein LX
ATGGCTAACTATATCGTAGAGGGCAGGTTCAAGGCCGGCGTCCAGTGGGAGAACTTCTCC
AAGGAAGTCGAGTCGGTCAACGAGAACACCGCCCGTGAAAAAGTCCTGTCCACGTTCGGC
AGCAAGCACGGCATCAACAGGAACCAGATAAAGATCGAATCGGTCAAGGAAGCGTAA


>MCP_0010 50S ribosomal protein LX
MANYIVEGRFKAGVQWENFSKEVESVNENTAREKVLSTFGSKHGINRNQIKIESVKEA

We have been distributing copies of the microbial genomic DNA clones constructed during the course of each of the genomic DNA sequencing projects.
You can find more detailed information at http://www.nbrc.nite.go.jp/e/mdna-e.html.