close all open/close all

CDS information : Actino_00200


close this sectionLocation

Organism
StrainA3(2) (=NBRC 15146)
Entry nameActinorhodin
Contig
Start / Stop / Direction20,631 / 20,891 / + [in whole cluster]
2,626 / 2,886 / + [in contig]
Location20631..20891 [in whole cluster]
2626..2886 [in contig]
TypeCDS
Length261 bp (86 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category1.1 PKS
Productpolyketide synthase acyl carrier protein subunit
Product (GenBank)Acyl carrier protein
GeneactI-ORF3
Gene (GenBank)actIORF3
EC number
Keyword
  • type II PKS
Note
Note (GenBank)
Reference
ACC
PmId
[1527048] Nucleotide sequence and deduced functions of a set of cotranscribed genes of Streptomyces coelicolor A3(2) including the polyketide synthase for the antibiotic actinorhodin. (J Biol Chem. , 1992)
[16285746] Self-malonylation is an intrinsic property of a chemically synthesized type II polyketide synthase acyl carrier protein. (Biochemistry. , 2005)
[19361520] Probing the Interactions of early polyketide intermediates with the Actinorhodin ACP from S. coelicolor A3(2). (J Mol Biol. , 2009)
[19381365] Preliminary kinetic analysis of acyl carrier protein-ketoacylsynthase interactions in the actinorhodin minimal polyketide synthase. (Mol Biosyst. , 2009)
[25406716] Modeling linear and cyclic PKS intermediates through atom replacement. (J Am Chem Soc. , 2014)

close this sectionPKS/NRPS Module

ACP6..79

close this sectionSequence

selected fasta
>polyketide synthase acyl carrier protein subunit [Acyl carrier protein]
MATLLTTDDLRRALVECAGETDGTDLSGDFLDLRFEDIGYDSLALMETAARLESRYGVSI
PDDVAGRVDTPRELLDLINGALAEAA
selected fasta
>polyketide synthase acyl carrier protein subunit [Acyl carrier protein]
ATGGCAACCCTGCTGACCACCGACGATCTGCGCCGCGCCCTCGTGGAGTGCGCCGGTGAG
ACGGACGGGACGGACCTGTCCGGCGACTTCCTCGACCTCCGCTTCGAGGACATCGGGTAC
GACTCGCTCGCCCTGATGGAGACCGCGGCGCGACTCGAGAGCCGGTACGGCGTGTCCATA
CCCGACGACGTCGCCGGCCGCGTCGACACGCCGCGAGAGCTGCTCGACCTGATCAACGGC
GCACTGGCCGAGGCGGCATGA
ACP6..79
ACP16..237

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
IPR006162 Phosphopantetheine attachment site (PTM)
 [37-52]  PS00012
PS00012   PHOSPHOPANTETHEINE
IPR009081 Acyl carrier protein-like (Domain)
 [6-79]  16.283 PS50075
PS50075   ACP_DOMAIN
 [24-78]  2.3e-08 PF00550
PF00550   PP-binding
 [1-86]  1.1e-15 SSF47336
SSF47336   ACP-like
 [6-84]  1.6e-15 G3DSA:1.10.1200.10
G3DSA:1.10.1200.10   no description
SignalP No significant hit
TMHMM No significant hit