close all open/close all

CDS information : Chro_00030


close this sectionLocation

Organism
StrainATCC 13273 (=NBRC 3746)
Entry nameChromomycin
Contig
Start / Stop / Direction1,836 / 1,585 / - [in whole cluster]
1,836 / 1,585 / - [in contig]
Locationcomplement(1585..1836) [in whole cluster]
complement(1585..1836) [in contig]
TypeCDS
Length252 bp (83 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category1.1 PKS
Productpolyketide synthase acyl carrier protein subunit
Product (GenBank)acyl carrier protein
Gene
Gene (GenBank)cmmS
EC number
Keyword
  • type II PKS
Note
Note (GenBank)
Reference
ACC
PmId
[15112992] Biosynthesis of the antitumor chromomycin A3 in Streptomyces griseus: analysis of the gene cluster and rational design of novel chromomycin analogs. (Chem Biol. , 2004)
Related Reference
ACC
Q56165
NITE
Jado_00100
PmId
[7881555] Cloning and characterization of polyketide synthase genes for jadomycin B biosynthesis in Streptomyces venezuelae ISP5230. (Microbiology. , 1994)
[9224566] Iterative type II polyketide synthases, cyclases and ketoreductases exhibit context-dependent behavior in the biosynthesis of linear and angular decapolyketides. (Chem Biol. , 1997)

close this sectionPKS/NRPS Module

ACP3..76

close this sectionSequence

selected fasta
>polyketide synthase acyl carrier protein subunit [acyl carrier protein]
MMTAEDLKRIMREGAGQDEGVDLDGDIADVPFTDLGYDSLALLETVSRVEREFGGPIADE
IVGAAKTPGEFLHLVNLGMSGAS
selected fasta
>polyketide synthase acyl carrier protein subunit [acyl carrier protein]
ATGATGACTGCGGAAGACCTGAAGAGGATCATGCGTGAGGGGGCTGGCCAGGACGAGGGC
GTCGATCTGGACGGTGACATCGCCGACGTGCCCTTCACCGACCTCGGGTACGACTCGCTC
GCCTTGCTGGAGACGGTGAGCAGGGTGGAGCGCGAGTTCGGGGGGCCGATCGCCGACGAG
ATCGTCGGCGCCGCGAAGACACCGGGCGAGTTCCTGCACCTCGTCAACCTGGGCATGTCG
GGGGCGAGCTGA
ACP3..76
ACP7..228

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
IPR006162 Phosphopantetheine attachment site (PTM)
 [34-49]  PS00012
PS00012   PHOSPHOPANTETHEINE
IPR009081 Acyl carrier protein-like (Domain)
 [2-75]  4.99999811956429e-12 SSF47336
SSF47336   ACP_like
 [3-76]  PS50075
PS50075   ACP_DOMAIN
 [27-74]  4.5e-07 PF00550
PF00550   PP-binding
 [3-75]  7.5e-13 G3DSA:1.10.1200.10
G3DSA:1.10.1200.10   ACP_like
SignalP No significant hit
TMHMM No significant hit