close all open/close all

CDS information : Gilvo_00200


close this sectionLocation

Organism
StrainGö 3592
Entry nameGilvocarcin
Contig
Start / Stop / Direction24,182 / 24,451 / + [in whole cluster]
24,182 / 24,451 / + [in contig]
Location24182..24451 [in whole cluster]
24182..24451 [in contig]
TypeCDS
Length270 bp (89 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category1.1 PKS
Productpolyketide synthase acyl carrier protein subunit
Product (GenBank)putative acyl carrier protein
Gene
Gene (GenBank)gilC
EC number
Keyword
  • type II PKS
Note
Note (GenBank)
  • GilC
Reference
ACC
PmId
[12822997] The complete gene cluster of the antitumor agent gilvocarcin V and its implication for the biosynthesis of the gilvocarcins. (J Am Chem Soc. , 2003)
Related Reference
ACC
Q56165
NITE
Jado_00100
PmId
[7881555] Cloning and characterization of polyketide synthase genes for jadomycin B biosynthesis in Streptomyces venezuelae ISP5230. (Microbiology. , 1994)
[9224566] Iterative type II polyketide synthases, cyclases and ketoreductases exhibit context-dependent behavior in the biosynthesis of linear and angular decapolyketides. (Chem Biol. , 1997)

close this sectionPKS/NRPS Module

ACP6..79

close this sectionSequence

selected fasta
>polyketide synthase acyl carrier protein subunit [putative acyl carrier protein]
MSARVTMDDLRRALEEGSGVDEGVDLDTDLETMAFSELGYDSLAVLETGLRLGRENDIEL
DDSVFADLDTPQQMLDAVNDALARQAAAS
selected fasta
>polyketide synthase acyl carrier protein subunit [putative acyl carrier protein]
ATGTCCGCACGCGTCACCATGGACGATCTCAGGCGAGCCCTCGAGGAGGGCTCCGGTGTC
GACGAGGGCGTCGATCTTGACACCGACCTCGAAACCATGGCGTTCTCCGAGCTGGGGTAC
GACTCCCTGGCGGTGCTGGAGACCGGCCTGCGCCTCGGCCGCGAGAACGACATCGAGCTC
GACGACTCGGTGTTCGCCGACCTCGACACGCCTCAGCAGATGCTGGACGCGGTCAACGAT
GCCCTCGCGCGTCAGGCGGCGGCATCGTGA
ACP6..79
ACP16..237

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
IPR009081 Acyl carrier protein-like (Domain)
 [6-83]  5.29999999999999e-13 G3DSA:1.10.1200.10
G3DSA:1.10.1200.10   ACP_like
 [1-86]  8.49999291746323e-12 SSF47336
SSF47336   ACP_like
 [10-78]  4.1e-07 PF00550
PF00550   PP-binding
 [6-79]  PS50075
PS50075   ACP_DOMAIN
SignalP No significant hit
TMHMM No significant hit