close all open/close all
first first   Jado_00010 Jado_00010

CDS information : Jado_00005


close this sectionLocation

Organism
StrainISP5230 (=NBRC 13096)
Entry nameJadomycin B
Contig
Start / Stop / Direction48 / 1 / - [in whole cluster]
48 / 1 / - [in contig]
Locationcomplement(1..48) [in whole cluster]
complement(1..48) [in contig]
TypeCDS
Length48 bp (15 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category4.1 transcriptional regulator
ProductTetR family transcriptional regulator(fragment)
gamma-butyrolactone receptor(fragment)
Product (GenBank)
GenejadR3
Gene (GenBank)
EC number
Keyword
Note
Note (GenBank)
Reference
PmId
[25116816] A gamma-butyrolactone-sensing activator/repressor, JadR3, controls a regulatory mini-network for jadomycin biosynthesis. (Mol Microbiol. , 2014)
Related Reference
ACC
F2RC03
PmId
[25116816] A gamma-butyrolactone-sensing activator/repressor, JadR3, controls a regulatory mini-network for jadomycin biosynthesis. (Mol Microbiol. , 2014)

close this sectionSequence

selected fasta
>TetR family transcriptional regulator(fragment)
MAQQARAIRTRRLILE
selected fasta
>TetR family transcriptional regulator(fragment)
TTGGCACAGCAAGCGCGTGCAATCCGAACCCGCCGGTTGATCCTCGAG

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
No significant hit
InterPro No significant hit
SignalP No significant hit
TMHMM No significant hit
first first   Jado_00010 Jado_00010