close all open/close all

CDS information : MUP_00800


close this sectionLocation

Organism
StrainAgy99
Entry nameMycolactone
Contig
Start / Stop / Direction171,939 / 171,667 / - [in whole cluster]
171,939 / 171,667 / - [in contig]
Locationcomplement(171667..171939) [in whole cluster]
complement(171667..171939) [in contig]
TypeCDS
Length273 bp (90 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category
Product
Product (GenBank)conserved hypothetical protein
Gene
Gene (GenBank)
EC number
Keyword
Note
Note (GenBank)
  • MUP080c, -, len: 90 aa. Conserved hypothetical protein, weakly similar to P71597|Y027_MYCTU|Rv0027 Hypothetical protein from M. tuberculosis (105 aa), fasta scores: opt: 117, E(): 0.3, (26.966% identity in 89 aa overlap).

close this sectionSequence

selected fasta
>[conserved hypothetical protein]
MRWAITQEHAADRCASARAENPHAIATAESWGPLFAEARRATVDAVNAREATLREQEEQH
RAMARQLRIAAARMEEMDAENRAALTISTD
selected fasta
>[conserved hypothetical protein]
ATGCGTTGGGCGATCACTCAGGAACACGCTGCCGACAGGTGTGCGAGTGCACGCGCTGAG
AATCCCCACGCGATAGCGACTGCCGAATCGTGGGGCCCGCTGTTCGCTGAGGCCCGTCGG
GCCACCGTTGATGCTGTCAATGCCCGTGAAGCCACGCTGCGCGAGCAAGAGGAGCAACAC
CGGGCCATGGCGCGACAGCTTCGCATCGCCGCGGCGCGCATGGAGGAGATGGACGCCGAG
AACCGGGCCGCATTGACCATCTCGACGGACTAG

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
IPR022536 ESX-1 secretion-associated protein EspC (Family)
 [2-85]  6e-17 PF10824
PF10824   DUF2580
SignalP
 [1-38]  0.101 Signal
Bacteria, Gram-positive   
 [1-19]  0.078 Signal
Eukaryota   
TMHMM No significant hit