close all open/close all
Megalo_00180 Megalo_00180   last last

CDS information : Megalo_00190


close this sectionLocation

Organism
StrainNRRL 3275 (=NBRC 14744)
Entry nameMegalomicin
Contig
Start / Stop / Direction47,981 / 47,411 / - [in whole cluster]
47,981 / 47,411 / - [in contig]
Locationcomplement(47411..47981) [in whole cluster]
complement(47411..47981) [in contig]
TypeCDS
Length571 bp (189 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category3.1 modification hydroxylation
Product6-deoxyerythronolide B C-6 hydroxylase
Product (GenBank)C-6 hydroxylase
Gene
Gene (GenBank)megF
EC number
Keyword
Note
Note (GenBank)
Reference
PmId
[10972798] Biosynthesis of the anti-parasitic agent megalomicin: transformation of erythromycin to megalomicin in Saccharopolyspora erythraea. (Mol Microbiol. , 2000)
[15870344] Production of the potent antibacterial polyketide erythromycin C in Escherichia coli. (Appl Environ Microbiol. , 2005)

close this sectionSequence

selected fasta
>6-deoxyerythronolide B C-6 hydroxylase [C-6 hydroxylase]
DPGPGRRRRPAQPRRTHLHRAGAAAGGIRGVGEPHRDRHLPAADPPRPARAGPEGPGTAA
RSGGGDPALPGPTGDHHPVRHRRGGDRRGDDPGVQHRPDRQRGGQPRPGTVPRPRPVRRH
QGQPGTPHLRARHPLLHGPPAGQAGGRGRPGGPVRPLPEAVAGLPLRRGCLAAVAPAARH
RPPAGATERM-
selected fasta
>6-deoxyerythronolide B C-6 hydroxylase [C-6 hydroxylase]
GATCCGGGTCCAGGACGACGACGCCGACCGGCTCAGCCGCGACGAACTCACCTCCATCGC
GCTGGTGCTGCTGCTGGCGGGATTCGAGGCGTCGGTGAGCCTCATCGGGATCGGCACCTA
CCTGCTGCTGACCCACCCCGACCAGCTCGCGCTGGTCCGGAAGGACCCGGCACTGCTGCC
CGGAGCGGTGGAGGAGATCCTGCGCTACCAGGCCCCACCGGAGACCACCACCCGGTTCGC
CACCGCCGAGGTGGAGATCGGCGGGGTGACGATCCCGGCGTACAGCACCGTCCTGATCGC
CAACGGGGCGGCCAACCGCGACCCGGGACAGTTCCCCGACCCCGACCGGTTCGACGTCAC
CAGGGACAGCCGGGGACACCTCACCTTCGGGCACGGCATCCACTACTGCATGGGCCGCCC
GCTGGCCAAGCTGGAGGGAGAGGTCGCCCTGGGGGCCCTGTTCGACCGCTTCCCGAAGCT
GTCGCTGGGCTTCCCCTCCGACGAGGTTGTCTGGCGGCGGTCGCTCCTGCTGCGCGGCAT
CGACCACCTGCCGGTGCGACCGAACGGATGA

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
No significant hit
InterPro
Database:interpro:38.0
No significant hit
SignalP
 [1-25]  0.418 Signal
Bacteria, Gram-negative   
 [1-23]  0.43 Signal
Bacteria, Gram-positive   
TMHMM No significant hit
Megalo_00180 Megalo_00180   last last