close all open/close all

CDS information : Mith_00160


close this sectionLocation

Organism
StrainATCC 12956
Entry nameMithramycin
Contig
Start / Stop / Direction19,209 / 19,466 / + [in whole cluster]
19,209 / 19,466 / + [in contig]
Location19209..19466 [in whole cluster]
19209..19466 [in contig]
TypeCDS
Length258 bp (85 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category1.1 PKS
Productpolyketide synthase acyl carrier protein subunit
Product (GenBank)acyl carrier protein
Gene
Gene (GenBank)mtmS
EC number
Keyword
  • type II PKS
Note
Note (GenBank)
Reference
ACC
PmId
[8654997] Characterization of Streptomyces argillaceus genes encoding a polyketide synthase involved in the biosynthesis of the antitumor mithramycin. (Gene. , 1996)
Related Reference
ACC
Q9X463
NITE
Naphcy_00030
PmId
[10206788] Isolation and characterization of the naphthocyclinone gene cluster from Streptomyces arenae DSM 40737 and heterologous expression of the polyketide synthase genes. (Gene. , 1999)
ACC
Q9F6C8
NITE
R1128_00140
PmId
[11732905] In vitro reconstitution and analysis of the chain initiating enzymes of the R1128 polyketide synthase. (Biochemistry. , 2001)
[12767243] Ketosynthases in the initiation and elongation modules of aromatic polyketide synthases have orthogonal acyl carrier protein specificity. (Biochemistry. , 2003)

close this sectionPKS/NRPS Module

ACP2..75

close this sectionSequence

selected fasta
>polyketide synthase acyl carrier protein subunit [acyl carrier protein]
MHLEDLTAVLRECAGESESAGLTTAALDVSFADLGYDSVAVLETTARIERDHGVVLDEEA
VSEAETLGQYLALVNEALADGTRAA
selected fasta
>polyketide synthase acyl carrier protein subunit [acyl carrier protein]
ATGCACCTGGAAGACCTCACCGCCGTGCTGCGCGAGTGCGCGGGCGAGAGCGAGAGCGCC
GGTCTGACCACGGCCGCCCTCGACGTCTCCTTCGCCGACCTCGGCTACGACTCGGTCGCC
GTCCTGGAGACCACGGCGCGCATCGAGCGCGATCACGGCGTCGTCCTCGACGAGGAGGCC
GTTTCCGAGGCGGAGACCCTGGGCCAGTACCTCGCCCTGGTCAACGAGGCGCTCGCCGAC
GGCACCCGTGCGGCCTGA
ACP2..75
ACP4..225

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
IPR006162 Phosphopantetheine attachment site (PTM)
 [33-48]  PS00012
PS00012   PHOSPHOPANTETHEINE
IPR009081 Acyl carrier protein-like (Domain)
 [3-81]  1.20000117458134e-11 SSF47336
SSF47336   ACP_like
 [23-73]  5.9e-08 PF00550
PF00550   PP-binding
 [3-79]  6.90000000000001e-12 G3DSA:1.10.1200.10
G3DSA:1.10.1200.10   ACP_like
 [2-75]  PS50075
PS50075   ACP_DOMAIN
SignalP No significant hit
TMHMM No significant hit