close all open/close all

CDS information : Nogl_00390


close this sectionLocation

Organism
StrainATCC 27451 (=NBRC 13445)
Entry nameNogalamycin
Contig
Start / Stop / Direction40,718 / 40,978 / + [in whole cluster]
12,016 / 12,276 / + [in contig]
Location40718..40978 [in whole cluster]
12016..12276 [in contig]
TypeCDS
Length261 bp (86 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category1.1 PKS
Productpolyketide synthase acyl carrier protein subunit
Product (GenBank)Snoa3
Gene
Gene (GenBank)snoa3
EC number
Keyword
  • type II PKS
Note
Note (GenBank)
Reference
ACC
PmId
[8668120] A gene cluster involved in nogalamycin biosynthesis from Streptomyces nogalater: sequence analysis and complementation of early-block mutations in the anthracycline pathway. (Mol Gen Genet. , 1996)

close this sectionPKS/NRPS Module

ACP6..79

close this sectionSequence

selected fasta
>polyketide synthase acyl carrier protein subunit [Snoa3]
MKQQLTTERLMEIMRECAGYGEDVDALGDTDGADFAALGYDSLALLETAGRLEREFGIQL
GDEVVADARTPAELTALVNRTVAEAA
selected fasta
>polyketide synthase acyl carrier protein subunit [Snoa3]
GTGAAGCAGCAGCTGACGACGGAACGGCTCATGGAGATCATGCGGGAGTGCGCGGGCTAC
GGTGAGGACGTCGACGCTCTGGGCGACACGGACGGCGCCGACTTCGCCGCACTCGGCTAC
GACTCGCTGGCGCTCCTGGAAACGGCCGGCCGGCTCGAGCGCGAGTTCGGCATCCAGCTC
GGTGACGAGGTGGTCGCCGACGCCAGGACGCCTGCCGAGCTGACCGCCCTGGTCAACCGG
ACGGTGGCCGAGGCGGCCTGA
ACP6..79
ACP16..237

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
IPR006162 Phosphopantetheine attachment site (PTM)
 [37-52]  PS00012
PS00012   PHOSPHOPANTETHEINE
IPR009081 Acyl carrier protein-like (Domain)
 [9-78]  5e-11 PF00550
PF00550   PP-binding
 [2-85]  9.40001006865064e-15 SSF47336
SSF47336   ACP_like
 [3-83]  5.59999999999999e-17 G3DSA:1.10.1200.10
G3DSA:1.10.1200.10   ACP_like
 [6-79]  PS50075
PS50075   ACP_DOMAIN
SignalP No significant hit
TMHMM No significant hit