close all open/close all

CDS information : Ovied_00030


close this sectionLocation

Organism
StrainATCC 11891
Entry nameOviedomycin
Contig
Start / Stop / Direction2,224 / 1,862 / - [in whole cluster]
2,224 / 1,862 / - [in contig]
Locationcomplement(1862..2224) [in whole cluster]
complement(1862..2224) [in contig]
TypeCDS
Length363 bp (120 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category4.1 transcriptional regulator
Productputative ArsR family transcriptional regulator
Product (GenBank)ArsR regulator
Gene
Gene (GenBank)
EC number
Keyword
Note
  • It is supposed that this ORF is not involved in oviedomycin biosynthesis.
Note (GenBank)
  • ORF3
Reference
ACC
PmId
[15368568] Genetic organization of the biosynthetic gene cluster for the antitumor angucycline oviedomycin in Streptomyces antibioticus ATCC 11891. (Chembiochem. , 2004)
Family/Domain
FD
IPR001845

close this sectionSequence

selected fasta
>putative ArsR family transcriptional regulator [ArsR regulator]
MRTTEETRLPQPDLATVEIGTVLQALADPVRLQIVRLLDTVGEAPCGALELPVGRSTVSH
HLRTLRESGLVETHLRGNTRVSRIRREELERRFPGLLASVLGATPAAQAGTAASDEEGER
selected fasta
>putative ArsR family transcriptional regulator [ArsR regulator]
ATGCGAACGACGGAGGAGACCCGGCTGCCGCAGCCGGACCTCGCCACGGTGGAGATCGGC
ACCGTGCTGCAAGCCCTCGCGGACCCGGTACGGCTGCAGATCGTGCGGTTGCTCGACACC
GTCGGCGAGGCGCCCTGCGGCGCGCTGGAGCTTCCGGTCGGGCGCTCCACCGTCTCCCAC
CACCTGCGCACCCTGCGCGAGAGCGGCCTCGTCGAGACGCATCTGCGGGGCAACACCCGG
GTCAGCCGGATCCGCCGCGAGGAGCTGGAACGGCGCTTCCCCGGACTGCTCGCCTCCGTC
CTGGGTGCCACGCCGGCCGCGCAAGCGGGCACGGCCGCGAGCGACGAGGAGGGGGAACGC
TAG

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
IPR001845 HTH ArsR-type DNA-binding domain (Domain)
 [11-104]  PS50987
PS50987   HTH_ARSR_2
 [21-98]  6.39998633403535e-19 SM00418
SM00418   HTH_ARSR
 [23-38]  1.59999889349252e-11 PR00778 [54-69]  1.59999889349252e-11 PR00778 [69-84]  1.59999889349252e-11 PR00778
PR00778   HTHARSR
IPR011991 Winged helix-turn-helix transcription repressor DNA-binding (Domain)
 [18-99]  1.2e-19 G3DSA:1.10.10.10
G3DSA:1.10.10.10   Wing_hlx_DNA_bd
SignalP
 [1-27]  0.118 Signal
Bacteria, Gram-negative   
 [1-32]  0.125 Signal
Eukaryota   
TMHMM No significant hit