close all open/close all

CDS information : Ovied_00130


close this sectionLocation

Organism
StrainATCC 11891
Entry nameOviedomycin
Contig
Start / Stop / Direction12,310 / 12,582 / + [in whole cluster]
12,310 / 12,582 / + [in contig]
Location12310..12582 [in whole cluster]
12310..12582 [in contig]
TypeCDS
Length273 bp (90 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category1.1 PKS
Productpolyketide synthase acyl carrier protein subunit
Product (GenBank)acyl carrier protein
Gene
Gene (GenBank)ovmS
EC number
Keyword
  • type II PKS
Note
Note (GenBank)
Reference
ACC
PmId
[15368568] Genetic organization of the biosynthetic gene cluster for the antitumor angucycline oviedomycin in Streptomyces antibioticus ATCC 11891. (Chembiochem. , 2004)
Related Reference
ACC
Q56165
NITE
Jado_00100
PmId
[7881555] Cloning and characterization of polyketide synthase genes for jadomycin B biosynthesis in Streptomyces venezuelae ISP5230. (Microbiology. , 1994)
[9224566] Iterative type II polyketide synthases, cyclases and ketoreductases exhibit context-dependent behavior in the biosynthesis of linear and angular decapolyketides. (Chem Biol. , 1997)

close this sectionPKS/NRPS Module

ACP7..81

close this sectionSequence

selected fasta
>polyketide synthase acyl carrier protein subunit [acyl carrier protein]
MATKEFTVDDLKRILLEGAGADESVDLDSADFLDSEFEALGYESLALLETGGRIEREFGI
TLDDTALTDATTPRALIEVVNAHIGQPTAV
selected fasta
>polyketide synthase acyl carrier protein subunit [acyl carrier protein]
ATGGCCACCAAGGAATTCACCGTCGACGACCTCAAGCGCATCCTCCTCGAAGGCGCCGGC
GCCGACGAGAGCGTCGACCTCGACAGCGCCGACTTCCTCGACTCCGAGTTCGAGGCGCTG
GGCTACGAGTCCCTGGCGCTGCTGGAGACCGGCGGCCGCATCGAGCGCGAGTTCGGCATC
ACGCTGGACGACACCGCGCTGACCGACGCCACCACCCCGCGTGCCCTCATCGAGGTCGTC
AACGCGCACATCGGTCAGCCCACCGCGGTCTGA
ACP7..81
ACP19..243

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
IPR006162 Phosphopantetheine attachment site (PTM)
 [39-54]  PS00012
PS00012   PHOSPHOPANTETHEINE
IPR009081 Acyl carrier protein-like (Domain)
 [4-89]  2.79999889404114e-12 SSF47336
SSF47336   ACP_like
 [11-79]  4.3e-09 PF00550
PF00550   PP-binding
 [4-86]  2.5e-17 G3DSA:1.10.1200.10
G3DSA:1.10.1200.10   ACP_like
 [7-81]  PS50075
PS50075   ACP_DOMAIN
SignalP
 [1-21]  0.051 Signal
Eukaryota   
TMHMM No significant hit