close all open/close all
first first   Salino_00020 Salino_00020

CDS information : Salino_00010


close this sectionLocation

Organism
StrainDSM 41398
Entry nameSalinomycin
Contig
Start / Stop / Direction2 / 586 / + [in whole cluster]
2 / 586 / + [in contig]
Location2..586 [in whole cluster]
2..586 [in contig]
TypeCDS
Length585 bp (194 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category
Product
Product (GenBank)electron transfer flavoprotein, beta subunit
Gene
Gene (GenBank)
EC number
Keyword
Note
Note (GenBank)

close this sectionSequence

selected fasta
>[electron transfer flavoprotein, beta subunit]
DAKDALRKALSMGADKGIHVEDDDLHGTDAVGTSLVLAKAIEKAGYDLVVSGMASTDGVV
GVVPALLAERLGVPQVTLLSEVSVADGVVKGRRDGDAATEELEASLPAVVSVTDQSGEAR
YPSFKGIMAAKKKPVESWDLSDLGLEAGEVGLEGAWTKVDSATERPARTAGKIITDEGEG
GKQLAAFLAERKFV
selected fasta
>[electron transfer flavoprotein, beta subunit]
GATGCGAAGGACGCGCTGCGCAAGGCGCTGTCGATGGGTGCGGACAAGGGCATCCACGTC
GAGGACGACGATCTGCACGGCACCGACGCCGTGGGTACCTCGCTGGTGCTGGCCAAGGCG
ATCGAGAAGGCGGGTTACGACCTGGTCGTCTCCGGTATGGCCTCGACCGACGGTGTGGTG
GGTGTCGTACCGGCGCTGCTCGCGGAGCGTCTGGGTGTGCCGCAGGTGACGCTGCTCTCC
GAGGTGTCGGTGGCGGACGGTGTGGTGAAGGGCCGCCGGGACGGCGATGCCGCCACCGAG
GAGCTGGAGGCCTCGCTTCCGGCCGTGGTCTCGGTCACCGACCAGTCCGGTGAGGCGCGT
TACCCCTCGTTCAAGGGGATCATGGCGGCCAAGAAGAAGCCGGTGGAGTCCTGGGACCTG
TCCGACCTGGGCCTGGAGGCCGGGGAGGTCGGCCTGGAGGGTGCCTGGACCAAGGTCGAC
TCCGCCACCGAGCGCCCGGCCCGTACCGCGGGCAAGATCATCACGGACGAGGGCGAGGGC
GGCAAGCAGCTCGCGGCCTTTCTCGCGGAGCGCAAGTTCGTATGA

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
IPR014729 Rossmann-like alpha/beta/alpha sandwich fold (Domain)
 [2-193]  5.19999999999996e-60 G3DSA:3.40.50.620
G3DSA:3.40.50.620   Rossmann-like_a/b/a_fold
IPR014730 Electron transfer flavoprotein, alpha/beta-subunit, N-terminal (Domain)
 [1-147]  1.99999636034521e-27 SM00893
SM00893   ETF
 [2-116]  2.90000000000001e-24 PF01012
PF01012   ETF
SignalP No significant hit
TMHMM No significant hit
first first   Salino_00020 Salino_00020