close all open/close all

CDS information : Tetrn_00050


close this sectionLocation

Organism
StrainNRRL 11266
Entry nameTetronomycin
Contig
Start / Stop / Direction6,245 / 6,472 / + [in whole cluster]
6,245 / 6,472 / + [in contig]
Location6245..6472 [in whole cluster]
6245..6472 [in contig]
TypeCDS
Length228 bp (75 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category2.1 modification addition of extender units
Productacyl carrier protein
Product (GenBank)acyl carrier protein
Gene
Gene (GenBank)tmn7a
EC number
Keyword
  • glyceroyl-CoA
Note
Note (GenBank)
Reference
ACC
PmId
[18404760] Analysis of the tetronomycin gene cluster: insights into the biosynthesis of a polyether tetronate antibiotic. (Chembiochem. , 2008)
[18046685] Glyceryl-S-acyl carrier protein as an intermediate in the biosynthesis of tetronate antibiotics. (Chembiochem. , 2008)
Related Reference
ACC
Q0R4L7
NITE
Chth_00370
PmId
[18586939] Cloning and characterization of the tetrocarcin A gene cluster from Micromonospora chalcea NRRL 11289 reveals a highly conserved strategy for tetronate biosynthesis in spirotetronate antibiotics. (J Bacteriol. , 2008)

close this sectionSequence

selected fasta
>acyl carrier protein [acyl carrier protein]
MTTIDDLVVLIRDELGLPVSVEDADRPLDEIAGWDSVHLLWLTAAIERRTGRSVSLPDLL
EAGSLNGIHKAAVAA
selected fasta
>acyl carrier protein [acyl carrier protein]
ATGACGACCATCGACGATCTTGTGGTGCTGATCCGTGACGAACTGGGGCTGCCGGTGTCC
GTCGAGGACGCCGACCGGCCTCTGGACGAGATCGCCGGCTGGGACTCGGTGCACCTGCTC
TGGCTGACGGCGGCGATCGAGCGCCGCACCGGCCGCAGCGTGTCGCTGCCGGACCTGCTG
GAAGCCGGCAGCCTCAACGGCATCCACAAGGCGGCGGTCGCGGCGTGA

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
IPR009081 Acyl carrier protein-like (Domain)
 [3-66]  3.4e-06 G3DSA:1.10.1200.10
G3DSA:1.10.1200.10   ACP_like
 [3-75]  1e-06 SSF47336
SSF47336   ACP_like
 [6-67]  5.60000000000001e-07 PF00550
PF00550   PP-binding
SignalP
 [1-24]  0.094 Signal
Bacteria, Gram-positive   
TMHMM No significant hit