close all open/close all
first first   Vicen_00020 Vicen_00020

CDS information : Vicen_00010


close this sectionLocation

Organism
StrainHC34
Entry nameVicenistatin
Contig
Start / Stop / Direction367 / 1 / - [in whole cluster]
367 / 1 / - [in contig]
Locationcomplement(1..367) [in whole cluster]
complement(1..367) [in contig]
TypeCDS
Length367 bp (121 aa)
Click on the icon to see Genetic map.

close this sectionAnnotation

Category4.1 transcriptional regulator
Productputative transcriptional regulator(fragment)
Product (GenBank)putative transcriptional activator
Gene
Gene (GenBank)vinR1
EC number
Keyword
Note
Note (GenBank)
Reference
ACC
PmId
[15112997] Cloning, sequencing, and functional analysis of the biosynthetic gene cluster of macrolactam antibiotic vicenistatin in Streptomyces halstedii. (Chem Biol. , 2004)
Related Reference
ACC
Q30CS9
NITE
Alip_00060
PmId
[19585113] Characterization and analysis of the regulatory network involved in control of lipomycin biosynthesis in Streptomyces aureofaciens Tu117. (Appl Microbiol Biotechnol. , 2010)

close this sectionSequence

selected fasta
>putative transcriptional regulator(fragment) [putative transcriptional activator]
MVFVERDEELHALGGLLGDATRGHGRAVLISGAIASGKTALLEALSHHALDSGALHLAAT
GAKAERELQLGVVDQLFRSVPLPADQAAHIAEIVTVDALLPGESELESRTLRQPEAHRIH
QI-
selected fasta
>putative transcriptional regulator(fragment) [putative transcriptional activator]
ATGGTGTTCGTGGAACGCGACGAGGAACTGCACGCCTTGGGAGGGTTGCTGGGTGACGCC
ACCCGGGGGCACGGGAGAGCCGTACTGATCAGTGGCGCCATAGCCTCCGGCAAGACTGCC
CTCCTGGAGGCACTGTCACACCACGCTCTCGACTCGGGCGCGCTGCATCTCGCGGCGACC
GGGGCCAAGGCAGAGCGTGAGCTACAACTCGGCGTGGTGGATCAGCTCTTCCGGAGCGTG
CCCCTGCCCGCCGATCAAGCCGCGCATATCGCTGAAATCGTCACAGTGGACGCATTACTG
CCGGGCGAGAGCGAGCTGGAGTCCCGCACGCTCCGGCAGCCCGAGGCCCATCGGATTCAC
CAGATCT

close this sectionFeature

BLASTP
Database:UniProtKB:2011_09
show BLAST table
InterPro
Database:interpro:38.0
No significant hit
SignalP
 [1-35]  0.16 Signal
Bacteria, Gram-positive   
TMHMM No significant hit
first first   Vicen_00020 Vicen_00020